Exenatide Prevents Diet-induced Hepatocellular Injury in A CEACAM1-Dependent Mechanism
Hilda E. Ghadieh1, Harrison T.Muturi2, Sonia M.Najjar1,2,3*
1Center for Diabetes and
Endocrine Research (CeDER), College of Medicine and Life Sciences, University
of Toledo, Toledo, OH, USA
2Department of Biomedical
Sciences, Heritage College of Osteopathic Medicine, Ohio University, Athens,
OH, USA
3Diabetes Institute, Heritage College of Osteopathic Medicine, Ohio University, Athens, OH, USA
*Corresponding author: Sonia M. Najjar, Department of Biomedical Sciences; Irvine Hall, Ohio University, Athens, OH 45701-2979, USA. Tel: +17405932376; Fax:+17405932778; Email: najjar@ohio.edu
Received Date: 27 November, 2017; Accepted Date: 11 December, 2017; Published Date: 19 December, 20171. Abstract
The Carcinoembryonic Antigen-Related Cell Adhesion Molecule1 (CEACAM1) promotes insulin sensitivity by inducing insulin clearance and reducing de novo lipogenesis in the liver. Consistently, Cc1–/–mice with null deletion of Ceacam1 gene exhibit hyperinsulinemia and insulin resistance, in addition to steatohepatitis. They also exhibit early pericellular fibrosis. Redelivering Ceacam1 to the liver reverses the altered metabolism and histopathology of Cc1–/– mice. Exenatide, a long-acting glucagon-like peptide-1 receptor agonist, induces Ceacam1 transcription and consequently, reverses impaired insulin clearance and insulin resistance caused by high-fat intake.Additionally, it reverses fat accumulation in the liver. The current studies show that exenatide also restored the activities of alanine transaminase and aspartate aminotransferase, and reversed the inflammatory and oxidative stress response to high-fat diet in wild-type, but not in Cc1–/– mice. Exenatide also prevented diet-induced activation of the TGFb/Smad2/Smad3 pro-fibrogenic pathways, and normalized the mRNA levels of pro-fibrogenic genes in wild-type, but not in Cc1–/– mice. Together, the data demonstrate that exenatide prevented diet-induced pro-fibrogenesis and hepatocellular injury in a CEACAM1-dependent mechanism.
2. Keywords: Fibrosis;
Glucagon-Like Peptide-1; Insulin Clearance; Insulin Resistance; Steatohepatitis
1. Nonstandard Abbreviations
ALT : Alanine Transaminase
AST : Aspartate Aminotransferase
CEACAM1 : Carcinoembryonic Antigen-Related Cell
Adhesion Molecule 1
Cc1–/– : Global Ceacam1 Null Mouse
Cc1+/+ : Wild-Type Littermate of Cc1–/–
GLP-1 : Glucagon-Like Peptide-1
RD : Regular Diet
HF : High-Fat Diet
2. Introduction
Nonalcoholic Fatty Liver Disease (NAFLD) ranges from benign steatosis to steatohepatitis and Non-Alcoholic Steatohepatitis (NASH) that also includes chicken-wire bridging fibrosis [1].Uncontrolled, the disease can progress to adenocarcinoma to constitute a major risk factor for liver transplant [2].
The paucity of mouse models that replicate faithfully NASH human disease and in particular fibrosis [3], has limited our understanding of its molecular underpinning and consequently, has restricted progress in the development of effective pharmacologic interventions. Studies in our laboratory have identified a role for the Carcinoembryonic Antigen-Related Cell Adhesion molecule 1 (CEACAM1) in inducing hepatic insulin clearance to promote insulin sensitivity and reduce hepatic de novo lipogenesis to protect the liver against the high level of insulin in the portal circulation [4]. Accordingly, mice with global null deletion of Ceacam1 gene (Cc1–/–)[5] and with liver-specific inactivation of CEACAM1 [6] develop impaired insulin clearance, followed by hyperinsulinemia and insulin resistance, in addition to fat accumulation in the liver, largely resulting from hyperinsulinemia-induced activation of the transcription of lipogenic genes [7,8]. With increased fat storage triggering changes in the inflammatory milieu [9,10], Ceacam1 mutants also develop steatohepatitis.Moreover, they develop a NASH-characteristic chicken-wire pattern of fibrosis on regular chow diet [5]. When fed a high-fat diet, these features of hepatocyte injury progress to include advanced chicken-wire fibrosis and apoptosis [11,12].
Recently, we have found that exenatide, a long-acting Glucagon-Like Peptide-I (GLP-I) receptor agonist and a synthetic analog of Exendin-4 that induces insulin secretion in part by inhibiting glucagon secretion [13,14], also induces CEACAM1-dependent hepatic insulin clearance [15]. Whereas exenatide reverses steatohepatitis in wild-type mice fed a high-fat diet, it fails to do so in Cc1–/– mice. The underlying mechanism involves the induction of Ceacam1 expression by binding directly to the peroxisome Proliferator-Activated Receptor Response Element (PPRE)/retinoid X receptor-a (RXRa) on the Ceacam1 promoter, and activating its transcription [15]. Thus, we aimed in the current study to investigate whether exenatide also ameliorates fibrosis, and whether this requires intact CEACAM1 expression.
3. Materials and Methods
3.1. Mice Maintenance
C57BL/6.Cc1−/− and Cc1+/+ littermates (3 months of age) were fed ad libitum a standard (RD) or a High-Fat (HF) diet deriving 45:35:20% calories from fat:carbohydrate:protein (D12451, Research Diets) for 2 months [16]. In the last month of feeding, mice received an intraperitoneal injection/day of saline or exenatide (20ng/g BW/day) (507-77, California Peptide Research, Salt Lake City, UT) [15]. All procedures were approved by the Institutional Animal Care and Utilization Committee at the University of Toledo.
3.2. ALT and AST Colorimetric Assays
Per
manufacturer’s instructions (Abcam, Cambridge, MA), liver tissues (50mg) were
homogenized in 200µl assay buffers, centrifuged (13,000xg, 10 min), and
aliquots from the supernatant layer were added to 100µl
of the reaction mix in the Alanine
Transaminase (ALT) (ab105134)and Aspartate Aminotransferase (AST) (ab105135) kits. The
products were read at OD570nm, and activities were measured in µM/mgmU/mg..
3.3. Western Blot Analysis
Livers were lysed and proteins analyzed by SDS-PAGE followed by immunoprobing with polyclonal antibodies against phospho-Smad2Ser465/467 and phospho-Smad3Ser423/425 (Cell signaling, Danvers, MA). For normalization, proteins were reprobed with polyclonal antibodies against Smad2 and Smad3 (Cell signaling). Blots were incubated with horseradish peroxidase-conjugated donkey anti-rabbit IgG antibody (GE Healthcare Life Sciences, Amersham, Marlborough, MA) and proteins were visualized using ECL (Amersham).
3.4. Liver Histology
As described [12], Formalin-fixed, paraffin-embedded liver sections were
stained with 0.1% Sirius Red stain (Sigma, Direct Red 80). Fibrosis was
assessed on deparaffinized and rehydrated slides and scored using the Brunt
Criteria [17,18].
3.5. Quantitative Real-time PCR Analysis
PerfectPure RNA Tissue Kit (5 PRIME Inc.) was used to isolated total RNA and cDNA was
synthesized by iScript cDNA Synthesis Kit (BIO-RAD), using 1μg of total RNA and oligo-dT primers (Table
1).cDNA was evaluated with qRT-PCR (StepOne
Plus, Applied Biosystems) and normalized to 18S. Results are expressed in fold change
as the mean±SEM.
3.6. Statistical Analysis
Data were analyzed by one-way ANOVA or the two-tailed Student-t-test using GraphPad Prism 6 software. P<0.05 was considered statistically significant.
4. Results
4.1. Effect of Exenatide on Hepatic ALT and AST Activities
Cc1–/– mice exhibited higher hepatic ALT (Figure
1A) and AST (Figure 1B) activities than their age-matched Cc1+/+wild-type counterparts, as previously reported [19]. HF feeding for 2 months elevated hepatic ALT and AST
activities in Cc1+/+ and Cc1–/– mice (Figure. 1A and 1B, HF-S vs RD-S). Treating with exenatide in the last 30
days of HF feeding reversed this increase in Cc1+/+, but not Cc1–/– mice (Figure 1A and 1B, HF-Ex vs HF-S).
4.2. Effect of Exenatide on Oxidative Stress and Inflammation
qRT-PCR analysis revealed that HF diet induced hepatic
mRNA levels of markers of oxidative stress, including Nox1, Nox 4 and Gp91, by ~2- to 3-fold in both groups of mice (Table
2, HF-S vs RD-S), as expected [20]. This was accompanied by a 2-fold increase in mRNA levels
of markers of inflammation (Il-6, IFNg and TNFa) (Table 2, HF-S vs RD-S). Exenatide treatment reversed the
positive effect of HF diet on the hepatic mRNA levels of the inflammatory and
oxidative stress markers in Cc1+/+, but not Cc1–/– mice (Table 2, HF-Ex
vs HF-S). That exenatide reversed inflammation in Cc1+/+, but not Cc1–/–mice, is supported by our previously published H&E
stain analysis [15].
4.3. Effect of Exenatide on Hepatic Fibrosis
qRT-PCR analysis showed higher mRNA levels of
pro-fibrotic genes (Col6-a3, a-Sma and TGFb) and lower mRNA levels of Smad7, an inhibitor of TGFb activation, in the liver of untreated HF-fed
relative to RD-fed Cc1+/+ mice (Table 1, HF-S
vs RD-S). Accordingly, Western blot analysis revealed induction of Smad2/Smad3
phosphorylation by HF diet in Cc1+/+mice (Figure2A,
HF-S vs RD-S). Sirius red staining showed periportal fibrosis in HF-S Cc1+/+mice (Figure 2Bii and a Brunt score of 2-accompanying table). Exenatide
treatment reversed these HF-induced profibrogenic parameters in Cc1+/+ mice (Table 2 and Figure2A,
HF-Ex vs S-Ex, and Figure2Biv with a Brunt score of 0). As expected from
our previous studies [12], Sirius red staining revealed perivenular
and/or pericellular bridging chicken-wire pattern of collagen deposition in the
liver of RD- and HF-fed Cc1−/− mice (Figure2Bv-vi and a Brunt score of 3). This NASH-like fibrosis in Cc1−/− mice, whether spontaneously (under RD
feeding conditions-Figure2Bv) or in response to HF diet (Figure
2Bvi) was not reversed by 4 weeks of exenatide
treatment (Figure2Bvii and Figure2Bviii, respectively and a Brunt score of 3). Consistently,
exenatide failed to normalize the mRNA levels of markers of fibrosis modulators
under both feeding conditions (Table 2,
RD/HF-Ex vs RD/HF-S), as well as it failed to reduce Smad2/Smad3 activation by
HF diet in Cc1–/–mice (Figure 2A, RD/HF-Ex
vs RD/HF-S).
5. Discussion
Cc1–/– mice develop insulin resistance,
steatohepatitis with spontaneous chicken-wire fibrosis that become more robust
in response to high-fat feeding [12].
Liver-specific rescuing of CEACAM1 expression reverses hyperinsulinemia,
insulin resistance, steatohepatitis and visceral obesity in Cc1–/– mice [21]. We have also shown that high-fat feeding for 21 days
reduces CEACAM1 expression by >50% in C56BL/6 mice to cause insulin
resistance and metabolically phenocopy the Cc1–/– mouse [16], but
forced liver-specific overexpression [16] and adenoviral-mediated redelivery of CEACAM1 [22] prevents these metabolic abnormalities together with the
rise in profibrogenic genes in HF-fed wild-type mice. Together, this suggests
that loss of CEACAM1 in liver plays a critical role in the pathogenesis of
metabolic and histological abnormalities detected in NAFLD.In support of this
proposed CEACAM1-based mechanism, exenatide reverses insulin resistance and
steatohepatitis in wild-type, but not Cc1–/– mice, via inducing Ceacam1 transcription [15]. The current studies showed that exenatide also reversed
the other features of hepatocyte injury caused by high-fat feeding in Cc1+/+, but not Cc1–/– mice. These include: activation of ALT and AST,
oxidative stress as assessed by changes in the mRNA levels of associated genes,
and of
the TGFb-mediated profibrogenic pathways in liver.
Normalization of ALT and AST activities, in addition to preventing the rise in inflammatory markers and inactivation of TGFb pathways by exenatide is consistent with the ameliorating effect of IP118, a GLP-1 receptor agonist, on these markers of hepatocyte injury in high-fat diet-fed C57BL/6 mice [23]. Failure of exenatide to modulate these metabolic and pathological phenotypes in RD- and HF-fed Cc1–/– mice points to the key role of CEACAM1 in mediating the beneficial effects of exenatide. Thus, it is likely that by binding to the PPRE/RXR element on the Ceacam1 promoter [15], exenatide induces CEACAM1 expression in liver to prevent the advancement of hepatocyte injury, including the increase in fat accumulation and inflammation caused by high-fat diet [24].
In addition to basal steatosis and inflammation, Cc1–/– mice exhibit low levels of pericellular fibrosis when fed a regular chow diet [12]. The current studies show that this is accompanied by basal induction of Smad2/Smad3 in the TGFbpathway, which similarly occurs in the liver of C57BL/6 mice fed a high-fat diet, likely resulting from the >50% decrease in hepatic CEACAM1 level by high-fat intake, as we have previously shown [16]. Reversal of these pathways by adenoviral-mediated liver-specific redelivery of CEACAM1 demonstrates the anti-fibrogenic role of hepatic CEACAM1 in the liver [22] as well as in the white adipose tissue [25]. Inactivation of the TGFb fibrogenic pathway by exenatide in Cc1+/+,but not Cc1–/– mice, further assigns a critical role for hepatic CEACAM1 induction in the anti-fibrogenic effect of exenatide.Mechanistically, the loss of hepatic CEACAM1 impairs insulin clearance to cause hyperinsulinemia, followed by insulin resistance and elevated hepatic de novo lipogenesis [8], both being risk factors for fibrosis [26]. Increased fat accumulation can change the inflammatory microenvironment [9,10] in the liver to release profibrogenic factors [27], and proinflammatory cytokines [28] that modify hepatic inflammation and contribute to fibrosis [24].
Moreover, increase in hepatic lipid production yields redistribution of substrates to the white adipose tissue to cause visceral adiposity followed by associated induction of the pro-inflammatory state, including the release of leptin, which can exacerbate the fibrogenic effect of TNFa[29; 30], which causes oxidative stress [31] and reduces Smad7 expression [32], leading to the activation of the TGFb/Smad2/Smad3 fibrogenic pathways. In addition to inducing the activity of TGFb, high-fat diet also increases its hepatic level together with that of the pro-fibrogenic factor, IL-6 [33,34], but with a rise in the anti-fibrogenic IFNg[34]. With exenatide inducing hepatic CEACAM1 production that contributes substantially to the decrease in visceral obesity [15], and subsequently, the pro-inflammatory state associated with high-fat feeding, it is conceivable that induction of CEACAM1 expression is required for the beneficial effect of exenatide not only in restoring the metabolic phenotype caused by high-fat intake, but also in limiting the progression of fibrosis.
6. Conclusion
Our data emphasize that induction of hepatic CEACAM1 by exenatide mediates its effect not only on insulin resistance, hepatic steatosis and visceral obesity [15], but also on the production of IL-6 and TNFa, which would, in turn limit their pro-inflammatory and pro-fibrogenic effect. The significance of this finding to human disease is highlighted by the reported low hepatic CEACAM1 levels in insulin resistance obese patients with fatty liver disease [35]. While by inducing CEACAM1 expression and promoting hepatic insulin clearance, exenatide maintains insulin levels at physiologic levels in the face of increased insulin secretion[15] in order to limit insulin resistance and steatohepatitis in animal models of NAFLD/NASH [36-38], the data supporting its clinical relevance and safety in the treatment of NASH remain limited [39] and warrant further investigations.
7. Acknowledgements
The authors thank Melissa W. Kopfman and
Zachary N. Smiley at the Najjar Laboratory at the University of Toledo College
of Medicine for their technical assistance in exenatide injections, and in the
generation and maintenance of mice. This work was supported by grants from the
National Institutes of Health; R01-DK054254, R01-DK083850, and R01-HL112248 to
SMN, and by fellowships from the Middle-East Diabetes Research Center to HEG.
The studies were also partially supported by the John J. Kopchick PhD Ohio
Heritage Foundation Eminent Research Chair Fund to SMN.
o
Figure 1:
Effect of exenatide on hepatic ALT and AST activities. Mice were fed with a Regular
Diet (RD) or a High-Fat Diet (HF) for 2 months and injected daily with either Saline
(S) or Exenatide (Ex) in the last month of feeding. At the end of the
feeding/treatment period, AST and ALT activities were measured in duplicate in
liver lysates (n=5 mice/ genotype/ feeding/ treatment). RD-S (white), RD-Ex
(light grey), HF-S (dark grey), and HF-Ex (black). Values are expressed as mean±SEM. *P<0.05 HF vs RD/ treatment group; †P<0.05 Ex vs S/ feeding group; ‡P<0.05 Cc1−/− vs Cc1+/+ mice/ feeding group/ treatment group.
Figure 2: Effect of
exenatide on hepatic fibrosis. A. Liver lysates were analyzed by
immunoblotting with α-phospho-Smad2 (α-pSmad2) and α-phospho-Smad3 (α-pSmad3) antibodies followed by reimmunoprobing
(reIb) with antibodies against total Smad2 and total Smad3, respectively, for
normalization. Gels represent more than 2 experiments performed on different
mice/ feeding/ treatment group.B: Liver histology were analyzed by Sirius red
staining to detect bridging fibrosis in Cc1–/–mice
(n=7-8/ genotype/ feeding/ treatment). Representatives from S-treated RD-fed (i and v), S-treated HF-fed (ii and vi),Ex-treated RD-fed (iii and vii); and Ex-treated HF-fed
mice (iv and viii) are shown.
The degree of fibrosis was evaluated per Brunt Criteria, and scores are
included in the accompanying table.
Primer
|
Forward Sequence (5'-3') |
Reverse Sequence (5'-3') |
Col6-a3 |
GTCAGCTGAGTCTTGTGCTGT |
ACCTAGAGAACGTTACCTCACT |
a-Sma |
CGTGGCTATTCCTTCGTTAC |
TGCCAGGAGACTCCATCC |
TGFβ |
GTGGAAATCAACGGGATCAG |
ACTTCCAACCCAGGTCCTTC |
Smad7 |
GTTGCTGTGAATCTTACGGG |
ATCTGGACAGCCTGCA |
IFNg |
ATG AACGCTACACACTGCATC |
CCATCCTTTTGCCAGTTCCTC |
IL-6 |
CTTGGGACTGCCGCTGGTGA |
TGCAAGTGCATCATCGTTGT |
TNFa |
CCACCACGCTCTTCTGTCTAC |
AGGGTCTGGGCCATAGAACT |
Nox1 |
TTACACGAGAGAAATTCTTGGG |
TCGACACACAGGAATCAGGA |
Nox4 |
TCCAAGCTCATTTCCCACAG |
CGGAGTTCCATTACATCAGAGG |
Gp91 |
TATGCTGATCCTGCTGCCAGT |
TGTCTTCGAATCCTTGTCGAGC |
18S |
TTCGAACGTCTGCCCTATCAA |
ATGGTAGGCACGGCGACTA |
Table 1: Primer sequence of mouse genes used in quantitative Real-time PCR analysis.
|
RD-S |
RD-Ex |
HF-S |
HF-Ex |
a) Cc1+/+ |
|
|
|
|
Fibrosis |
|
|
|
|
Col6-a3 |
2.11 ± 0.22 |
2.33 ± 0.20 |
6.11 ± 0.30* |
2.37 ± 0.25† |
a-Sma |
3.02 ± 0.34 |
3.15 ± 0.31 |
6.99 ± 0.29* |
3.19 ± 0.23† |
TGFb |
2.36 ± 0.26 |
2.18 ± 0.21 |
6.16 ± 0.28* |
2.13 ± 0.26† |
Smad7 |
1.36 ± 0.04 |
1.41 ± 0.04 |
0.38 ± 0.06* |
1.47 ± 0.04† |
Oxidative stress |
|
|
|
|
Nox1 |
1.12 ± 0.07 |
1.21 ± 0.06 |
3.26 ± 0.12* |
1.28 ± 0.11† |
Nox4 |
1.08 ± 0.05 |
1.11 ± 0.07 |
3.01 ± 0.10* |
1.22 ± 0.12† |
Gp91 |
1.11 ± 0.12 |
1.16 ± 0.08 |
2.98 ± 0.17* |
1.12 ± 0.13† |
Inflammation |
|
|
|
|
Il-6 |
4.46 ± 0.18 |
4.21 ± 0.11 |
8.71 ± 0.21* |
4.23 ± 0.19† |
IFNg |
7.22 ± 0.18 |
6.87 ± 0.25 |
12.5 ± 0.25* |
6.88 ± 0.15† |
TNFa |
3.07 ± 0.21 |
2.86 ± 0.22 |
6.86 ± 0.22* |
2.73 ± 0.11† |
|
|
|
|
|
Fibrosis |
|
|
|
|
Col6-a3 |
3.84 ± 0.18 |
4.07 ± 0.33 |
10.6 ± 0.41* |
10.8 ± 0.41* |
a-Sma |
5.47 ± 0.30 |
5.68 ± 0.35 |
12.9 ± 0.44* |
12.7 ± 0.42* |
TGFb |
5.22 ± 0.26 |
5.47 ± 0.33 |
12.5 ± 0.47* |
12.0 ± 0.49* |
Smad7 |
2.88 ± 0.10 |
3.09 ± 0.07 |
1.74 ± 0.10* |
1.76 ± 0.07* |
Oxidative stress |
|
|
|
|
Nox1 |
1.34 ± 0.11 |
1.45 ± 0.15 |
3.87 ± 0.18* |
3.58 ± 0.17* |
Nox4 |
1.02 ± 0.12 |
1.13 ± 0.11 |
3.57 ± 0.22* |
3.48 ± 0.20* |
Gp91 |
1.36 ± 0.22 |
1.43 ± 0.21 |
3.03 ± 0.28* |
3.11 ± 0.24* |
Inflammation |
|
|
|
|
Il-6 |
7.13 ± 0.21 |
7.43 ± 0.14 |
13.4 ± 0.31* |
12.9 ± 0.34* |
IFNg |
7.22 ± 0.19 |
7.41 ± 0.18 |
14.3 ± 0.21* |
14.1 ± 0.27* |
TNFa |
5.51 ± 0.23 |
5.74 ± 0.22 |
11.2 ± 0.27* |
11.0 ± 0.21* |
Male Mice (3-month-old) were fed RD or HF for 2 months. In the last 30 days of feeding, they were injected intraperitoneally once daily with Saline (S) or Exenatide (Ex) (20ng/g BW) (n=5/genotype/feeding/treatment). Hepatic qRT-PCR analysis was carried out in triplicate and normalized to 18S. Values are expressed as mean±SEM. *P<0.05 HF versus RD/each of S or Ex treatment group; †P<0.05 Ex versus S/each of RD or HF feeding group |
Table 2: Effect of Exenatide on the mRNA levels of genes in the liver of male mice.
- Spengler EK, Loomba R (2015)
Recommendations for Diagnosis, Referral for Liver Biopsy, and Treatment of
Nonalcoholic Fatty Liver Disease and Nonalcoholic Steatohepatitis. Mayo Clin
Proc 90: 1233-1246.
- Ascha MS, Hanouneh IA, Lopez R,
Tamimi TA, Feldstein AF, et al.(2010) The incidence and risk factors of
hepatocellular carcinoma in patients with nonalcoholic steatohepatitis.
Hepatology 51: 1972-1978.
- S.K. Erickson (2009) Nonalcoholic fatty liver
disease. J. Lipid Res 50: S412-S416.
- Ward GM, Walters
JM, Aitken PM, Best JD, AlfordFP (1990) Effects of prolonged pulsatile hyperinsulinemia
in humans. Enhancement of insulin sensitivity. Diabetes 39: 501-507.
- DeAngelis AM,
Heinrich G, Dai T, Bowman TA, Patel PR, et al. (2008) Carcinoembryonic
antigen-related cell adhesion molecule 1: a link between insulin and lipid
metabolism. Diabetes 57: 2296-2303.
- Poy MN, Yang Y, Rezaei K, Fernstrom MA,
Lee AD, et al. (2002) CEACAM1 regulates insulin clearance in liver. Nat Genet
30: 270-276.
- Horton JD, Goldstein JL, Brown MS
(2002) SREBPs: activators of the complete program of cholesterol and fatty acid
synthesis in the liver. The Journal of clinical investigation 109: 1125-1131.
- Heinrich G,
Ghadieh HE, Ghanem SS, Muturi HT, Rezaei K, et al. (2017) Loss of Hepatic
CEACAM1: A Unifying Mechanism Linking Insulin Resistance to Obesity and
Non-Alcoholic Fatty Liver Disease. Front Endocrinol 8.
- Sheth SG, Gordon FD, Chopra S (1997)
Nonalcoholic steatohepatitis. Ann Intern Med 126: 137-145.
- Bigorgne AE, Bouchet-Delbos L,
Naveau S, Dagher I, Prévot S, et al. (2008) Obesity-induced lymphocyte
hyperresponsiveness to chemokines: a new mechanism of Fatty liver inflammation
in obese mice. Gastroenterology 134: 1459-1469.
- Lee SJ, Heinrich G, Fedorova L,
Al-Share QY, Ledford KJ (2008) Development of nonalcoholic steatohepatitis in
insulin-resistant liver-specific S503A carcinoembryonic antigen-related cell
adhesion molecule 1 mutant mice. Gastroenterology 135: 2084-2095.
- Ghosh S, Kaw M,
Patel PR, Ledford KJ, Bowman TA, et al, (2010) Mice with null mutation of
Ceacam I develop nonalcoholic steatohepatitis. Hepat Med Res Evidence: 69-78.
- DruckerDJ(2015) Deciphering
metabolic messages from the gut drives therapeutic innovation: the 2014 Banting
Lecture. Diabetes 64: 317-326.
- D'Alessio D (2016) Is GLP-1 a hormone: Whether and
When? J. Diabetes Investig. 7: 50-55.
- Ghadieh HE,
Muturi HT, Russo L, Marino CC, Ghanem SS, S et al, (2017) Exenatide induces
carcinoembryonic antigen-related cell adhesion molecule 1 expression to prevent
hepatic steatosis. Hepatololy Commun.
- Al-Share QY,
DeAngelis AM, Lester SG, Bowman TA, Ramakrishnan SK, et al. (2015) Forced Hepatic
Overexpression of CEACAM1 Curtails Diet-Induced Insulin Resistance. Diabetes 64:
2780-2790.
- Santiago-Rolón A, Purcell D,
Rosado K, Toro DH (2015) A Comparison of Brunt's Criteria, the Non-Alcoholic
Fatty Liver Disease Activity Score (NAS), and a Proposed NAS Scoring that
Includes Fibrosis in Non-Alcoholic Fatty Liver Disease Staging. PR Health Sci J
34: 189-194.
- Brown GT, Kleiner DE (2016) Histopathology
of nonalcoholic fatty liver disease and nonalcoholic steatohepatitis.
Metabolism 65: 1080-1086.
- Xu E, Dubois MJ, Leung N,
Charbonneau A, Turbide C, et al. (2009) Targeted disruption of carcinoembryonic
antigen-related cell adhesion molecule 1 promotes diet-induced hepatic
steatosis and insulin resistance. Endocrinology 150: 3503-3512.
- Robertson G, Leclercq I, Farrell
GC (2001) Nonalcoholic steatosis and steatohepatitis. II. Cytochrome P-450
enzymes and oxidative stress. Am J Physiol Gastrointest Liver Physiol 281:
G1135-G1139.
- Russo L1 Muturi HT, Ghadieh HE,
Ghanem SS, Bowman TA, et al. (2017) Liver-specific reconstitution of CEACAM1
reverses the metabolic abnormalities caused by its global deletion in male
mice. Diabetologia 60: 2463-2474.
- Russo L, Ghadieh HE, Ghanem SS,
Al-Share QY, Smiley ZN,et al. (2016) Role for hepatic CEACAM1 in regulating
fatty acid metabolism along the adipocyte-hepatocyte axis. JLipid Res 57: 2163-2175.
- Jouihan H, Will S, Guionaud S,
Boland ML, Oldham S, et al. (2017) Superior reductions in hepatic steatosis and
fibrosis with co-administration of a glucagon-like peptide-1 receptor agonist
and obeticholic acid in mice. Mol Metab 6: 1360-1370.
- Najjar SM, Russo L (2014) CEACAM1
loss links inflammation to insulin resistance in obesity and non-alcoholic
steatohepatitis (NASH). SeminImmunopathol 36: 55-71.
- Lester SG, Russo
L, Ghanem SS, Khuder SS, DeAngelis AM, et al. (2015) Hepatic CEACAM1
Over-Expression Protects Against Diet-Induced Fibrosis and Inflammation in
White Adipose Tissue. Front Endocrinol (Lausanne) 6: 116-122.
- Angulo P, Keach JC, Batts KP,
Lindor KD (1999) Independent predictors of liver fibrosis in patients with
nonalcoholic steatohepatitis. Hepatology 30: 1356-1362.
- Wobser H, Dorn C, Weiss TS, Amann
T, Bollheimer C, et al. (2009) Lipid accumulation in hepatocytes induces
fibrogenic activation of hepatic stellate cells. Cell Res 19: 996-1005.
- Li BH, He FP, Yang X, Chen YW,
Fan JG (2017) Steatosis induced CCL5 contributes to early-stage liver fibrosis
in nonalcoholic fatty liver disease progress. Transl Res 180: 103-117.
- Manco M, Marcellini M, Giannone
G, Nobili V (2007) Correlation of Serum TNF-alpha Levels and Histologic Liver
Injury Scores in Pediatric Nonalcoholic Fatty Liver Disease. Am J Clin Pathol
127: 954-960.
- Carter-Kent C, Zein NN, Feldstein
AE (2008) Cytokines in the pathogenesis of fatty liver and disease progression
to steatohepatitis: implications for treatment. Am J Gastroenterol 103: 1036-1042.
- Crespo J, Cayón A, Fernández-Gil
P, Hernández-Guerra M, Mayorga M, et al. (2001) Gene expression of tumor
necrosis factor alpha and TNF-receptors, p55 and p75, in nonalcoholic
steatohepatitis patients. Hepatology 34: 1158-1163.
- Nagarajan RP, Chen F, Li W, Vig
E, Harrington MA, et al. (2000) Repression of
transforming-growth-factor-beta-mediated transcription by nuclear factor
kappaB. Biochem J 348: 591-596.
- Syn WK1, Choi SS, Diehl AM (2009)
Diehl, Apoptosis and cytokines in non-alcoholic steatohepatitis. Clin Liver Dis
13: 565-580.
- Bhogal RK, Bona CA (2005) B
cells: no longer bystanders in liver fibrosis. J Clin Invest 115: 2962-2965.
- LeeW (2011)The
CEACAM1 expression is decreased in the liver of severely obese patients with or
without diabetes. Diagn. Pathol 6: 40.
- Svegliati-Baroni G, Saccomanno S,
Rychlicki C, Agostinelli L, De Minicis S, et al. (2011) Glucagon-like peptide-1
receptor activation stimulates hepatic lipid oxidation and restores hepatic
signalling alteration induced by a high-fat diet in nonalcoholic
steatohepatitis. Liver Int 31: 1285-1297.
- Trevaskis JL, Griffin PS, Wittmer
C, Neuschwander-Tetri BA, Brunt EM, et al. (2012) Glucagon-like peptide-1
receptor agonism improves metabolic, biochemical, and histopathological indices
of nonalcoholic steatohepatitis in mice. Am JPhysiol Gastrointest Liver Physiol
302: G762-G772.
- Ding X1, Saxena NK, Lin S, Gupta
NA, Anania FA (2006) Exendin-4, a glucagon-like protein-1 (GLP-1) receptor
agonist, reverses hepatic steatosis in ob/ob mice. Hepatology 43: 173-181.
- Le TA, Loomba R (2012) Management of Non-alcoholic
Fatty Liver Disease and Steatohepatitis. J Clin Exp Hepatol 2: 156-173.